T7 RNA Polymerase

Catalog #: EG-1060
Product Description
Product Name T7 RNA Polymerase
Catalog Number EG-1060
Description T7 RNA Polymerase, a recombinant enzyme from bacteriophage T7 expressed in Escherichia coli, catalyzes 5’ to 3’ RNA synthesis from single-stranded or double-stranded DNA templates downstream of a T7 promoter (TAATACGACTCACTATAGGGAGA), ideal for RNA probe preparation and in vitro transcription studies.
Applications
  • Radiolabeled RNA probe preparation
  • RNA synthesis for in vitro translation
  • RNA synthesis for studies of RNA structure, processing, and catalysis
  • Expression control via antisense RNA
Source Recombinant Escherichia coli expressing the T7 bacteriophage gene 1
Unit Definition One unit is defined as the amount of enzyme that incorporates 1 nmol of ATP into acid-insoluble material in 1 hour at 37°C under standard RNA polymerase assay conditions.
Components
  • T7 RNA Polymerase: 50,000 units/mL in 50 mM Tris-HCl (pH 7.9 at 25°C), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 0.1% (v/v) Triton X-100, 50% (v/v) glycerol
  • 10X Reaction Buffer: 400 mM Tris-HCl (pH 7.9 at 25°C), 60 mM MgCl2, 100 mM DTT, 20 mM spermidine
Quality Control
  • Absence of endo- and exodeoxyribonucleases and ribonucleases confirmed by appropriate quality tests
  • Functionally validated in in vitro transcription reactions
Storage -20°C
Shipping Dry ice
Related Products
Catalog #Product NamePriceAdd to Cart
EG-1028Pfu DNA Polymerase0.00
EG-150Yeast Poly(A) Polymerase495.00
EG-82Bsu DNA Polymerase, Large Fragment0.00
EG-149E. coli Poly(A) Polymerase0.00
EG-219Exonuclease Deficient T4 DNA Polymerase0.00
EG-151Schizosaccharomyces pombe Poly(U) Polymerase495.00