T7 RNA Polymerase

Catalog #: EG-1060

$0.00

Product Description

Product Name	T7 RNA Polymerase
Catalog Number	EG-1060
Description	T7 RNA Polymerase, a recombinant enzyme from bacteriophage T7 expressed in Escherichia coli, catalyzes 5’ to 3’ RNA synthesis from single-stranded or double-stranded DNA templates downstream of a T7 promoter (TAATACGACTCACTATAGGGAGA), ideal for RNA probe preparation and in vitro transcription studies.
Applications	Radiolabeled RNA probe preparation RNA synthesis for in vitro translation RNA synthesis for studies of RNA structure, processing, and catalysis Expression control via antisense RNA
Source	Recombinant Escherichia coli expressing the T7 bacteriophage gene 1
Unit Definition	One unit is defined as the amount of enzyme that incorporates 1 nmol of ATP into acid-insoluble material in 1 hour at 37°C under standard RNA polymerase assay conditions.
Components	T7 RNA Polymerase: 50,000 units/mL in 50 mM Tris-HCl (pH 7.9 at 25°C), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 0.1% (v/v) Triton X-100, 50% (v/v) glycerol 10X Reaction Buffer: 400 mM Tris-HCl (pH 7.9 at 25°C), 60 mM MgCl₂, 100 mM DTT, 20 mM spermidine
Quality Control	Absence of endo- and exodeoxyribonucleases and ribonucleases confirmed by appropriate quality tests Functionally validated in in vitro transcription reactions
Storage	-20°C
Shipping	Dry ice

Related Products

Catalog #	Product Name	Price	Add to Cart
EG-1028	Pfu DNA Polymerase	0.00
EG-150	Yeast Poly(A) Polymerase	495.00
EG-82	Bsu DNA Polymerase, Large Fragment	0.00
EG-149	E. coli Poly(A) Polymerase	0.00
EG-219	Exonuclease Deficient T4 DNA Polymerase	0.00
EG-151	Schizosaccharomyces pombe Poly(U) Polymerase	495.00